Welcome, Guest. Please login or register.

Autor Subiect: Molecula fundamentala a vietii nu ar fi ADN-ul, ci ARN-ul  (Citit de 38770 ori)

0 Membri şi 1 Vizitator vizualizează acest subiect.

Ella_Kosta

  • Vizitator
Re: Molecula fundamentala a vietii nu ar fi ADN-ul, ci ARN-ul
« Răspuns #45 : Iunie 18, 2009, 02:19:38 a.m. »
Parca s-ar vbi de chimie la general pe aici... Poi nu degeaba carbonul sta la baza vietii, si se crede ca e posibil sa fie chiar singurul capabil de asta, sau in orice caz cel mai capabil element.

Cand vbiti de probabilitati, luati in calcul si faptul ca unele reactii chiar au loc pt ca asa e facuta natura asta. In orice molecula posibila nu a pus nimeni la intamplare si dupa probabilitati anume elemente combinate fix in acel fel, ci au avut loc reactii chimice in anumite conditii favorabile. Bineinteles ca viata este ceva formidabil de complex ca sa ne dam seama exact cum a aparut si eventual sa reproducem fenomenul. Cel putin deocamdata.

Ganditi-va ca primele celule au aparut cel putin acum 3,7 mld ani. Extraordinar de lenta a fost evolutia, din moment ce avem o explozie de tot felul de animale complexe abia de acum 500 mil. ani incoace.

Nu uitati nici de numarul important de elemente de baza pt viata gasite in spatiu, formate in conditii in care nu se credea ca pot aparea si exista.

Offline Adi

  • Global Moderator
  • *****
  • Mesaje postate: 11301
  • Popularitate: +15/-7
    • Site personal Adrian Buzatu
Re: Molecula fundamentala a vietii nu ar fi ADN-ul, ci ARN-ul
« Răspuns #46 : Iunie 18, 2009, 03:32:47 p.m. »
Bine ai revenit la noi pe forum! Relativ la aparitia vietii pe Terra, va recomand animatia asta, cu povestea unei molecule de apa. Cred ca sunt mai multe animatii pe site si poate unele vor si despre ARN si ADN ...
« Ultima Modificare: Mai 27, 2012, 09:14:40 a.m. de Scientia »
Pagina personala: http://adrianbuzatu.ro

inger_demonizat

  • Vizitator
Re: Molecula fundamentala a vietii nu ar fi ADN-ul, ci ARN-ul
« Răspuns #47 : Iulie 12, 2009, 03:00:10 a.m. »
Bun!

O proteina este formata din multi aminoacizi legati intr-o anumita ordine unul de altul. Fiecare aminoacid este codificat de 3 baze ( ACT, AGG, etc am dat un exemplu). Ca sa obtin o proteina simpla cu sa zicem 10000 de aminoacizi ( si e chiar simpla) imi trebuie 30 000 de baze asta afra sa includem secventa de START si STOP. Asta inseamna o sansa de 1/4^30000?


Daca vei sta sa faci si un calcul de masa probabil nu vei gasi atata carbon pe pamant ca sa poti efectua toate combinatiile. Si asta fara sa tinem si de structura si de interactiuni.

Apropo. Nimeni nu aminteste nimic de sursa de energie care este necesara pt a lega doua nocleotide una de cealalta?Oare care o fi fost in acea supa primitiva. Cand ma refer la energie ma refer la energia de reactie rezultata dintr-o alta reactie chimica. In cazul vietii cunoscute ATP (adenozin trifosfat) care se descompune in ADP( adenozin difosfat) si un rst fosfat care se leaga de ARN si permite sa se mai adauge inca o baza si tot asa.


scuze k ma bag ca o musca in laptic dar am o rugaminte la dvs. Epresia asta: Ca sa obtin o proteina simpla cu sa zicem 10000 de aminoacizi ( si e chiar simpla) mi se pare trasa de par, adik fara sa par ipocrit departe de mn gandu asta o minciuna. cea mai simpla proteiena insumneaza undeva la 40 de resuri de aminoaczi sau chiar mai putin. De vreo 2 ani am inceput sa traduc din codu de o litera in codu de trei litere secventa aminoiacizilor din molecula proteinelor pornind de la proteinele bacteriene si terminand cu cele umane. ca exemplu sa te convingi k cea ce vb este adevar si nu fabulatie iti las un link unde gasesti o gramada de proteine si ai sa gaseste cea ce am zis eu http://www.ncbi.nlm.nih.gov/sutils/genom_table.cgi  .

ma citez singur

am decis sa aduc o secventa la care am lucrat o zi intreaga sa dovedesc complexitatea proteinelor
este vorba de o proteina umana:

Proteina A2M

MGKNKLLHPSLVLLLLVLLPTDASVSGKPQYMVLVPSLLHTETTEKGCVLLSYLNETVTVSASLESVRG N
RSLFTDLEAENDVLHCVAFAVPKSSSNEEVMFLTVQVKGPTQEFKKRTTVMVKNEDSLVFVQTDKSIYK P
GQTVKFRVVSMDENFHPLNELIPLVYIQDPKGNRIAQWQSFQLEGGLKQFSFPLSSEPFQGSYKVVVQK K
SGGRTEHPFTVEEFVLPKFEVQVTVPKIITILEEEMNVSVCGLYTYGKPVPGHVTVSICRKYSDASDCH G
EDSQAFCEKFSGQLNSHGCFYQQVKTKVFQLKRKEYEMKLHTEAQIQEEGTVVELTGRQSSEITRTITK L
SFVKVDSHFRQGIPFFGQVRLVDGKGVPIPNKVIFIRGNEANYYSNATTDEHGLVQFSINTTNVMGTSL T
VRVNYKDRSPCYGYQWVSEEHEEAHHTAYLVFSPSKSFVHLEPMSHELPCGHTQTVQAHYILNGGTLLG L
KKLSFYYLIMAKGGIVRTGTHGLLVKQEDMKGHFSISIPVKSDIAPVARLLIYAVLPTGDVIGDSAKYD V
ENCLANKVDLSFSPSQSLPASHAHLRVTAAPQSVCALRAVDQSVLLMKPDAELSASSVYNLLPEKDLTG F
PGPLNDQDDEDCINRHNVYINGITYTPVSSTNEKDMYSFLEDMGLKAFTNSKIRKPKMCPQLQQYEMHG P
EGLRVGFYESDVMGRGHARLVHVEEPHTETVRKYFPETWIWDLVVVNSAGVAEVGVTVPDTITEWKAGA F
CLSEDAGLGISSTASLRAFQPFFVELTMPYSVIRGEAFTLKATVLNYLPKCIRVSVQLEASPAFLAVPV E
KEQAPHCICANGRQTVSWAVTPKSLGNVNFTVSAEALESQELCGTEVPSVPEHGRKDTVIKPLLVEPEG L
EKETTFNSLLCPSGGEVSEELSLKLPPNVVEESARASVSVLGDILGSAMQNTQNLLQMPYGCGEQNMVL F
APNIYVLDYLNETQQLTPEIKSKAIGYLNTGYQRQLNYKHYDGSYSTFGERYGRNQGNTWLTAFVLKTF A
QARAYIFIDEAHITQALIWLSQRQKDNGCFRSSGSLLNNAIKGGVEDEVTLSAYITIALLEIPLTVTHP V
VRNALFCLESAWKTAQEGDHGSHVYTKALLAYAFALAGNQDKRKEVLKSLNEEAVKKDNSVHWERPQKP K
APVGHFYEPQAPSAEVEMTSYVLLAYLTAQPAPTSEDLTSATNIVKWITKQQNAQGGFSSTQDTVVALH A
LSKYGAATFTRTGKAAQVTIQSSGTFSSKFQVDNNNRLLLQQVSLPELPGEYSMKVTGEGCVYLQTSLK Y
NILPEKEEFPFALGVQTLPQTCDEPKAHTSFQISLSVSYTGSRSASNMAIVDVKMVSGFIPLKPTVKML E
RSNHVSRTEVSSNHVLIYLDKVSNQTLSLFFTVLQDVPVRDLKPAIVKVYDYYETDEFAIAEYNAPCSK D
    LGNA.

Met-Gly-Lys-Asn-Lys-Leu-Leu-His-Pro-Ser-Leu-Val-Leu-Leu-Leu-Leu-Val-Leu-Leu-Pro-Thr-Asp-Ala-Ser-Val-Ser-Gly-Lys-Pro-Gln-Tyr-Met-Val-Leu-Val-Pro-Ser-Leu-Leu-His-Thr-Glu-Thr-Thr-Glu-Lys-Gly-Cys-Val-Leu-Leu-Ser-Tyr-Leu-Asn-Glu-Thr-Val-Thr-Val-Ser-Ala-Ser-Leu-Glu-Ser-Val-Arg-Gly-Asn-Arg-Ser-Leu-Phe-Thr-Asp-Leu-Glu-Ala-Glu-Asn-Asp-Val-Leu-His-Cys-Val-Ala-Phe-Ala-Val-Pro-Lys-Ser-Ser-Ser-Asn-Glu-Glu-Val-Met-Phe-Leu-Thr-Val-Gln-Val-Lys-Gly-Pro-Thr-Gln-Glu-Phe-Lys-Lys-Arg-Thr-Thr-Val-Met-Val-Lys-Asn-Glu-Asp-Ser-Leu-Val-Phe-Val-Gln-Thr-Asp-Lys-Ser-Ile-Tyr-Lys-Pro-Gly-Gln-Thr-Val-Lys-Phe-Arg-Val-Val-Ser-Met-Asp-Glu-Asn-Phe-His-Pro-Leu-Asn-Glu-Leu-Ile-Pro-Leu-Val-Tyr-Ile-Gln-Asp-Pro-Lys-Gly-Asn-Arg-Ile-Ala-Gln-Trp-Gln-Ser-Phe-Gln-Leu-Glu-Gly-Gly-Leu-Lys-Gln-Phe-Ser-Phe-Pro-Leu-Ser-Ser-Glu-Pro-Phe-Gln-Gly-Ser-Tyr-Lys-Val-Val-Val-Gln-Lys-Lys-Ser-Gly-Gly-Arg-Thr-Glu-His-Pro-Phe-Thr-Val-Glu-Glu-Phe-Val-Leu-Pro-Lys-Phe-Glu-Val-Gln-Val-Thr-Val-Pro-Lys-Ile-Ile-Thr-Ile-Leu-Glu-Glu-Glu-Met-Asn-Val-Ser-Val-Cys-Gly-Leu-Tyr-Thr-Tyr-Gly-Lys-Pro-Val-Pro-Gly-His-Val-Thr-Val-Ser-Ile-Cys-Arg-Lys-Tyr-Ser-Asp-Ala-Ser-Asp-Cys-His-Gly-Glu-Asp-Ser-Gln-Ala-Phe-Cys-Glu-Lys-Phe-Ser-Gly-Gln-Leu-Asn-Ser-His-Gly-Cys-Phe-Tyr-Gln-Gln-Val-Lys-Thr-Lys-Val-Phe-Gln-Leu-Lys-Arg-Lys-Glu-Tyr-Glu-Met-Lys-Leu-His-Thr-Glu-Ala-Gln-Ile-Gln-Glu-Glu-Gly-Thr-Val-Val-Glu-Leu-Thr-Gly-Arg-Gln-Ser-Ser-Glu-Ile-Thr-Arg-Thr-Ile-Thr-Lys-Leu-Ser-Phe-Val-Lys-Val-Asp-Ser-His-Phe-Arg-Gln-Gly-Ile-Pro-Phe-Phe-Gly-Gln-Val-Arg-Leu-Val-Asp-Gly-Lys-Gly-Val-Pro-Ile-Pro-Asn-Lys-Val-Ile-Phe-Ile-Arg-Gly-Asn-Glu-Ala-Asn-Tyr-Tyr-Ser-Asn-Ala-Thr-Thr-Asp-Glu-His-Gly-Leu-Val-Gln-Phe-Ser-Ile-Asn-Thr-Thr-Asn-Val-Met-Gly-Thr-Ser-Leu-Thr-Val-Arg-Val-Asn-Tyr-Lys-Asp-Arg-Ser-Pro-Cys-Tyr-Gly-Tyr-Gln-Trp-Val-Ser-Glu-Glu-His-Glu-Glu-Ala-His-His-Thr-Ala-Tyr-Leu-Val-Phe-Ser-Pro-Ser-Lys-Ser-Phe-Val-His-Leu-Glu-Pro-Met-Ser-His-Glu-Leu-Pro-Cys-Gly-His-Thr-Gln-Thr-Val-Gln-Ala-His-Tyr-Ile-Leu-Asn-Gly-Gly-Thr-Leu-Leu-Gly-Leu-Lys-Lys-Leu-Ser-Phe-Tyr-Tyr-Leu-Ile-Met-Ala-Lys-Gly-Gly-Ile-Val-Arg-Thr-Gly-Thr-His-Gly-Leu-Leu-Val-Lys-Gln-Glu-Asp-Met-Lys-Gly-His-Phe-Ser-Ile-Ser-Ile-Pro-Val-Lys-Ser-Asp-Ile-Ala-Pro-Val-Ala-Arg-Leu-Leu-Ile-Tyr-Ala-Val-Leu-Pro-Thr-Gly-Asp-Val-Ile-Gly-Asp-Ser-Ala-Lys-Tyr-Asp-Val-Glu-Asn-Cys-Leu-Ala-Asn-Lys-Val-Asp-Leu-Ser-Phe-Ser-Pro-Ser-Gln-Ser-Leu-Pro-Ala-Ser-His-Ala-His-Leu-Arg-Val-Thr-Ala-Ala-Pro-Gln-Ser-Val-Cys-Ala-Leu-Arg-Ala-Val-Asp-Gln-Ser-Val-Leu-Leu-Met-Lys-Pro-Asp-Ala-Glu-Leu-Ser-Ala-Ser-Ser-Val-Tyr-Asn-Leu-Leu-Pro-Glu-Lys-Asp-Leu-Thr-Gly-Phe-Pro-Gly-Pro-Leu-Asn-Asp-Gln-Asp-Asp-Glu-Asp-Cys-Ile-Asn-Arg-His-Asn-Val-Tyr-Ile-Asn-Gly-Ile-Thr-Tyr-Thr-Pro-Val-Ser-Ser-Thr-Asn-Glu-Lys-Asp-Met-Tyr-Ser-Phe-Leu-Glu-Asp-Met-Gly-Leu-Lys-Ala-Phe-Thr-Asn-Ser-Lys-Ile-Arg-Lys-Pro-Lys-Met-Cys-Pro-Gln-Leu-Gln-Gln-Tyr-Glu-Met-His-Gly-Pro-Glu-Gly-Leu-Arg-Val-Gly-Phe-Tyr-Glu-Ser-Asp-Val-Met-Gly-Arg-Gly-His-Ala-Arg-Leu-Val-His-Val-Glu-Glu-Pro-His-Thr-Glu-Thr-Val-Arg-Lys-Tyr-Phe-Pro-Glu-Thr-Trp-Ile-Trp-Asp-Leu-Val-Val-Val-Asn-Ser-Ala-Gly-Val-Ala-Glu-Val-Gly-Val-Thr-Val-Pro-Asp-Thr-Ile-Thr-Glu-Trp-Lys-Ala-Gly-Ala-Phe-Cys-Leu-Ser-Glu-Asp-Ala-Gly-Leu-Gly-Ile-Ser-Ser-Thr-Ala-Ser-Leu-Arg-Ala-Phe-Gln-Pro-Phe-Phe-Val-Glu-Leu-Thr-Met-Pro-Tyr-Ser-Val-Ile-Arg-Gly-Glu-Ala-Phe-Thr-Leu-Lys-Ala-Thr-Val-Leu-Asn-Tyr-Leu-Pro-Lys-Cys-Ile-Arg-Val-Ser-Val-Gln-Leu-Glu-Ala-Ser-Pro-Ala-Phe-Leu-Ala-Val-Pro-Val-Glu-Lys-Glu-Gln-Ala-Pro-His-Cys-Ile-Cys-Ala-Asn-Gly-Arg-Gln-Thr-Val-Ser-Trp-Ala-Val-Thr-Pro-Lys-Ser-Leu-Gly-Asn-Val-Asn-Phe-Thr-Val-Ser-Ala-Glu-Ala-Leu-Glu-Ser-Gln-Glu-Leu-Cys-Gly-Thr-Glu-Val-Pro-Ser-Val-Pro-Glu-His-Gly-Arg-Lys-Asp-Thr-Val-Ile-Lys-Pro-Leu-Leu-Val-Glu-Pro-Glu-Gly-Leu-Glu-Lys-Glu-Thr-Thr-Phe-Asn-Ser-Leu-Leu-Cys-Pro-Ser-Gly-Gly-Glu-Val-Ser-Glu-Glu-Leu-Ser-Leu-Lys-Leu-Pro-Pro-Asn-Val-Val-Glu-Glu-Ser-Ala-Arg-Ala-Ser-Val-Ser-Val-Leu-Gly-Asp-Ile-Leu-Gly-Ser-Ala-Met-Gln-Asn-Thr-Gln-Asn-Leu-Leu-Gln-Met-Pro-Tyr-Gly-Cys-Gly-Glu-Gln-Asn-Met-Val-Leu-Phe-Ala-Pro-Asn-Ile-Tyr-Val-Leu-Asp-Tyr-Leu-Asn-Glu-Thr-Gln-Gln-Leu-Thr-Pro-Glu-Ile-Lys-Ser-Lys-Ala-Ile-Gly-Tyr-Leu-Asn-Thr-Gly-Tyr-Gln-Arg-Gln-Leu-Asn-Tyr-Lys-His-Tyr-Asp-Gly-Ser-Tyr-Ser-Thr-Phe-Gly-Glu-Arg-Tyr-Gly-Arg-Asn-Gln-Gly-Asn-Thr-Trp-Leu-Thr-Ala-Phe-Val-Leu-Lys-Thr-Phe-Ala-Gln-Ala-Arg-Ala-Tyr-Ile-Phe-Ile-Asp-Glu-Ala-His-Ile-Thr-Gln-Ala-Leu-Ile-Trp-Leu-Ser-Gln-Arg-Gln-Lys-Asp-Asn-Gly-Cys-Phe-Arg-Ser-Ser-Gly-Ser-Leu-Leu-Asn-Asn-Ala-Ile-Lys-Gly-Gly-Val-Glu-Asp-Glu-Val-Thr-Leu-Ser-Ala-Tyr-Ile-Thr-Ile-Ala-Leu-Leu-Glu-Ile-Pro-Leu-Thr-Val-Thr-His-Pro-Val-Val-Arg-Asn-Ala-Leu-Phe-Cys-Leu-Glu-Ser-Ala-Trp-Lys-Thr-Ala-Gln-Glu-Gly-Asp-His-Gly-Ser-His-Val-Tyr-Thr-Lys-Ala-Leu-Leu-Ala-Tyr-Ala-Phe-Ala-Leu-Ala-Gly-Asn-Gln-Asp-Lys-Arg-Lys-Glu-Val-Leu-Lys-Ser-Leu-Asn-Glu-Glu-Ala-Val-Lys-Lys-Asp-Asn-Ser-Val-His-Trp-Glu-Arg-Pro-Gln-Lys-Pro-Lys-Ala-Pro-Val-Gly-His-Phe-Tyr-Glu-Pro-Gln-Ala-Pro-Ser-Ala-Glu-Val-Glu-Met-Thr-Ser-Tyr-Val-Leu-Leu-Ala-Tyr-Leu-Thr-Ala-Gln-Pro-Ala-Pro-Thr-Ser-Glu-Asp-Leu-Thr-Ser-Ala-Thr-Asn-Ile-Val-Lys-Trp-Ile-Thr-Lys-Gln-Gln-Asn-Ala-Gln-Gly-Gly-Phe-Ser-Ser-Thr-Gln-Asp-Thr-Val-Val-Ala-Leu-His-Ala-Leu-Ser-Lys-Tyr-Gly-Ala-Ala-Thr-Phe-Thr-Arg-Thr-Gly-Lys-Ala-Ala-Gln-Val-Thr-Ile-Gln-Ser-Ser-Gly-Thr-Phe-Ser-Ser-Lys-Phe-Gln-Val-Asp-Asn-Asn-Asn-Arg-Leu-Leu-Leu-Gln-Gln-Val-Ser-Leu-Pro-Glu-Leu-Pro-Gly-Glu-Tyr-Ser-Met-Lys-Val-Thr-Gly-Glu-Gly-Cys-Val-Tyr-Leu-Gln-Thr-Ser-Leu-Lys-Tyr-Asn-Ile-Leu-Pro-Glu-Lys-Glu-Glu-Phe-Pro-Phe-Ala-Leu-Gly-Val-Gln-Thr-Leu-Pro-Gln-Thr-Cys-Asp-Glu-Pro-Lys-Ala-His-Thr-Ser-Phe-Gln-Ile-Ser-Leu-Ser-Val-Ser-Tyr-Thr-Gly-Ser-Arg-Ser-Ala-Ser-Asn-Met-Ala-Ile-Val-Asp-Val-Lys-Met-Val-Ser-Gly-Phe-Ile-Pro-Leu-Lys-Pro-Thr-Val-Lys-Met-Leu-Glu-Arg-Ser-Asn-His-Val-Ser-Arg-Thr-Glu-Val-Ser-Ser-Asn-His-Val-Leu-Ile-Tyr-Leu-Asp-Lys-Val-Ser-Asn-Gln-Thr-Leu-Ser-Leu-Phe-Phe-Thr-Val-Leu-Gln-Asp-Val-Pro-Val-Arg-Asp-Leu-Lys-Pro-Ala-Ile-Val-Lys-Val-Tyr-Asp-Tyr-Tyr-Glu-Thr-Asp-Glu-Phe-Ala-Ile-Ala-Glu-Tyr-Asn-Ala-Pro-Cys-Ser-Lys-Asp-Leu-Gly-Asn-Ala.



inger_demonizat

  • Vizitator
Re: Molecula fundamentala a vietii nu ar fi ADN-ul, ci ARN-ul
« Răspuns #48 : Iulie 12, 2009, 03:11:18 a.m. »
Subiectul ma depaseste, dar am totusi o observatie: cred ca pentru a se autoreproduce o molecula de "ceva" trebuie sa aiba un anumit grad (minim) de complexitate. Altfel, probabil ca s-ar observa si azi aparitia unor asemenea molecule. Daca o proteina "simpla" se compune din 10 000 de aminoacizi, una "foarte simpla" ar putea fi formata din 1 000, dar si sansa producerii acesteia pe cale naturala (dupa formula de mai sus) ar fi foarte foarte mica, chiar si la scara geologica.



sceptic  am o alta secventa care combate un pic  cele expuse de dumneavoastra
AhnVgp017

MVSLFSTSKVMVLPVRVFTKICIFENKILILIRDHNERVQARFTITHRTNRGRFSNRPQVSFR

Met-Val-Ser-Leu-Phe-Ser-Thr-Ser-Lys-Val-Met-Val-Leu-Pro-Val-Arg-Val-Phe-Thr-Lys
Ile-Cys-Ile-Phe-Glu-Asn-Lys-Ile-Leu-Ile-Leu-Ile-Arg-Asp-His-Asn-Glu-Arg-Val-Gln-
Ala-Arg-Phe-Thr-Ile-Thr-His-Arg-Thr-Asn-Arg-Gly-Arg-Phe-Ser-Asn-Arg-Pro-Gln-Val-
Ser-Phe-Arg.
codificata de gena cu secventa nucleotidica:
ATGGTATCGCTATTTTCTACATCTAAGGTAATGGTTTTACCTGTCAGAGTTTTTACAAAAATTTGCATA T
TTGAAAATAAAATTTTAATACTTATAAGAGATCACAATGAACGAGTTCAGGCGCGATTTACAATTACAC A
CCGAACGAATCGTGGCCGATTCTCCAATCGACCCCAAGTCTCGTTTAGGTGA
proteina=63 aminoacizi
gena=192 baze azotate
gena face parte din genomul virusului Adoxophyes honmai NPV

Offline Adi

  • Global Moderator
  • *****
  • Mesaje postate: 11301
  • Popularitate: +15/-7
    • Site personal Adrian Buzatu
Re: Molecula fundamentala a vietii nu ar fi ADN-ul, ci ARN-ul
« Răspuns #49 : Iulie 12, 2009, 05:32:14 p.m. »
Cand zici secventa de proteine, poti sa spui ce inseamna acele litere? La ADN ai 4 litere care se tot repeta. La o proteina nu ai la fel vad. Atunci ce este acolo?
Pagina personala: http://adrianbuzatu.ro

inger_demonizat

  • Vizitator
Re: Molecula fundamentala a vietii nu ar fi ADN-ul, ci ARN-ul
« Răspuns #50 : Iulie 12, 2009, 05:48:01 p.m. »
Daca la ADN exstista 4 litere sare se repeta si la ARN exista 20 de litere(aminoacizii) care se repeta...
A-Alanina
C-cisteina
D-acid aspartic etc
lantul acel pe care l-am expus mai sus a fost scris in codu de o litera (MACTRDF....) si apoi l-am decodificat in codul de trei litere (Met-Ala-Cys-Thr-Arg-Asp-Phe)

Offline Adi

  • Global Moderator
  • *****
  • Mesaje postate: 11301
  • Popularitate: +15/-7
    • Site personal Adrian Buzatu
Re: Molecula fundamentala a vietii nu ar fi ADN-ul, ci ARN-ul
« Răspuns #51 : Iulie 12, 2009, 05:49:42 p.m. »
Stiam ca la ARN sunt tot 4 litere, trei comune cu ADN-ul si una speciala.
Pagina personala: http://adrianbuzatu.ro

Offline graethel

  • Experimentat
  • ***
  • Mesaje postate: 310
  • Popularitate: +0/-0
Re: Molecula fundamentala a vietii nu ar fi ADN-ul, ci ARN-ul
« Răspuns #52 : Iulie 12, 2009, 05:54:28 p.m. »
@inger-demonizat

Cred ca vrei sa spui din cele 4 litere se formeaza mai multe combinatii de cate 3 codoni (atentie, ordinea conteaza), dintre care numai 20 apar in celula si ele se numesc aminoacizi. Are dreptate Adi, ARN are tot 4 caramizi fundamentale.

Iata tabelul cu aminoacizii unde sunt specificati codonii ce ii alcatuiesc:

http://en.wikipedia.org/wiki/Genetic_code#RNA_codon_table

Offline Adi

  • Global Moderator
  • *****
  • Mesaje postate: 11301
  • Popularitate: +15/-7
    • Site personal Adrian Buzatu
Re: Molecula fundamentala a vietii nu ar fi ADN-ul, ci ARN-ul
« Răspuns #53 : Iulie 12, 2009, 05:59:28 p.m. »
Ah, asa e mai clar. Mersi, Flavia. In plus, stiu ca unii din acei aminoacizi chiar se gasesc in spatiul cosmic, creati in mod natural de natura. Exista giganti gazosi moleculari, unde are loc o intreaga chimie in spatiul cosmic. De asta e foarte plauzibil ca viata a aparut relativ usor pe Pamant, caci deja in spatiu fusesera formate molecule complexe chimice ...
Pagina personala: http://adrianbuzatu.ro

inger_demonizat

  • Vizitator
Re: Molecula fundamentala a vietii nu ar fi ADN-ul, ci ARN-ul
« Răspuns #54 : Iulie 12, 2009, 06:17:17 p.m. »
@inger-demonizat

Cred ca vrei sa spui din cele 4 litere se formeaza mai multe combinatii de cate 3 codoni (atentie, ordinea conteaza), dintre care numai 20 apar in celula si ele se numesc aminoacizi. Are dreptate Adi, ARN are tot 4 caramizi fundamentale.

Iata tabelul cu aminoacizii unde sunt specificati codonii ce ii alcatuiesc:

http://en.wikipedia.org/wiki/Genetic_code#RNA_codon_table

un codon este format din 3 baze azotate(nucleotide) si codonii sunt unitatile ce codifica formarea lanturilor polipoptidice si nu aminoacizii sunt formati din codoni
de exemplu codomul ATG semnifica inceputul mesajului genetic
TAG, TAA si TGA semnifica codonii stop sau nonsens, cei care marcheaza sfarsitul mesajului genetic
conform celor expuse de tine mai sus inseamna ca cei trei codoni STOP si codonul STAR(care codifica in acelasi timp si metionina) alcatuiesc aminoacizi? nu prea cred sincer.....si ca dovada aduc chiar tabelul expus de tine uitate mai bine in tabel si ai sa vezi ca am dreptate fara suparare

Offline Adi

  • Global Moderator
  • *****
  • Mesaje postate: 11301
  • Popularitate: +15/-7
    • Site personal Adrian Buzatu
Re: Molecula fundamentala a vietii nu ar fi ADN-ul, ci ARN-ul
« Răspuns #55 : Iulie 12, 2009, 06:18:54 p.m. »
Trebuie sa ma documentez exact cu terminologia. Intre timp, poate raspunde Raul.
Pagina personala: http://adrianbuzatu.ro

Offline graethel

  • Experimentat
  • ***
  • Mesaje postate: 310
  • Popularitate: +0/-0
Re: Molecula fundamentala a vietii nu ar fi ADN-ul, ci ARN-ul
« Răspuns #56 : Iulie 12, 2009, 06:22:58 p.m. »
Da, scuze, ai dreptate, codonii sunt formati din baze azotate.

Insa in afirmatia de mai jos e ceva in neregula, adica se bate cap in cap cu ce am invatat in liceu (acolo se limiteaza cunostiintele mele de genetica).

Daca la ADN exstista 4 litere sare se repeta si la ARN exista 20 de litere(aminoacizii) care se repeta...

Acum analizand inca o data fraza, cred ca cele 4 litere din ADN si cele 20 de litere din ARN nu se refera la aceeasi chestie. Adica 4 litere din ADN se refera la bazele azotate, iar cele 20 din ARN se refera la ce? Nu cumva la codoni? Codon e totuna cu aminoacid? ARN nu are la baza, la cel mai mic nivel tot baze azotate?

inger_demonizat

  • Vizitator
Re: Molecula fundamentala a vietii nu ar fi ADN-ul, ci ARN-ul
« Răspuns #57 : Iulie 12, 2009, 06:33:34 p.m. »
Da, scuze, ai dreptate, codonii sunt formati din baze azotate.

Insa in afirmatia de mai jos e ceva in neregula, adica se bate cap in cap cu ce am invatat in liceu (acolo se limiteaza cunostiintele mele de genetica).

draga mea colega caci am inteles ca esti fata sau ma insel?
la liceu se invata ceva foarte da foarte evaporat si acum am stat si am  analizat fraza si recunosc si eu o greseala in exprimare si imi cer scuze public am vrut sa zic altcerva dar am gresit
din propia experienta la scoala se invata, cam 30% cu aproximatie, niste teoreme destul de vagi asa mai pentru mintea copiilor
oricum eu am detestat scoala si o detest prefer sa urmez 3 facultati decat o zi la liceu sau generala scuze asta e parerea mea.....
« Ultima Modificare: Iulie 12, 2009, 08:10:52 p.m. de Adi »

Offline graethel

  • Experimentat
  • ***
  • Mesaje postate: 310
  • Popularitate: +0/-0
Re: Molecula fundamentala a vietii nu ar fi ADN-ul, ci ARN-ul
« Răspuns #58 : Iulie 12, 2009, 06:38:40 p.m. »
Da, corect, ala e scopul liceului, sa inveti chestii generale, nu are nimeni pretentia sa iesi doxa de acolo. Ai nevoie de scoala ca sa inveti sa citesti si sa scrii si sa musti un pic din fiecare domeniu ca sa iti dai seama ce vrei de la viata, eventual sa dezvolti niscai aptitudini sociale. Asa vad eu liceul si scoala generala.

Eu fac facultate de fizica, deci nu am tangenta cu domeniul genetica, am minime cunostiinte. Nu e nici o rusine sa nu stii si sa gresesti.
« Ultima Modificare: Iulie 12, 2009, 06:40:41 p.m. de graethel »

inger_demonizat

  • Vizitator
Re: Molecula fundamentala a vietii nu ar fi ADN-ul, ci ARN-ul
« Răspuns #59 : Iulie 12, 2009, 06:57:08 p.m. »
eu nu consider a gresi o rusine niciodata nu am catalogat asa
ma bucur caci cineva se axeaza pe stiinte exacte